Stir continuously for three hours, maintaining the temperature at 37C. o VEKLURY injection (supplied as 100 mg/20 mL [5 mg/mL] solution in vial) must be diluted in a 250 mL 0.9% sodium chloride infusion bag. Specifically, the term refers to a gene which is derived from a wild-type replicase gene but comprises a nucleotide sequence which causes it to encode a variant replicase protein as defined herein. Subscribe to Drugs.com newsletters for the latest medication news, new drug approvals, alerts and updates. Ammayapppan et al., Identification of sequence changes responsible for the attenuation of avian infectious bronchitis virus strain Arkansas DPI, Arch. As a false negative result may occur in the ferricyanide test, it is recommended that either the glucose oxidase or hexokinase methods are used to determine blood/plasma glucose levels in patients receiving cefuroxime sodium. In order to determine whether the identified mutations were responsible for the loss of pathogenicity associated with M41-R, the Nsp10 mutation was repaired and the mutations in Nsp-14, -15 & -16 were repaired and shown to grow in a similar manner as M41-CK (FIG. Cool to room temperature and dilute to 500 ml with distilled water. Dextrose containing IV solution not recommended. 3). There are also efficacy problems associated with the process: some mutations will affect the replication of the virus and some of the mutations may make the virus too attenuated. AJOG's Editors have active research programs and, on occasion, publish work in the Journal. The results (Table 8) show that the hatch percentage for IB M41-R hatch was low, and 19 of 40 hatched and the chicks were weak. Coronaviruses are divided into four groups, as shown below: The variant replicase gene of the coronavirus of the present invention may be derived from an alphacoronavirus such as TGEV; a betacoronavirus such as MHV; or a gammacoronavirus such as IBV. To bookmark a medicine you must sign up and log in. The lipid envelope contains three membrane proteins: S, M and E. The IBV S protein is a type I glycoprotein which oligomerizes in the endoplasmic reticulum and is assembled into homotrimer inserted in the virion membrane via the transmembrane domain and is associated through non-covalent interactions with the M protein. The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. Coronavirus particles may be harvested, for example from the supernatant, by methods known in the art, and optionally purified. Meat-type birds have reduced weight gain, whilst egg-laying birds lay fewer eggs and produce poor quality eggs. Add a hot solution of 1.25 g of copper sulphate pentahydrate in 20 ml of water and shake for ten minutes. Comments: Dosing should be individualized on the basis of disease and patient response The present invention provides a coronavirus comprising a variant replicase gene which, when expressed in the coronavirus, causes the virus to have reduced pathogenicity compared to a corresponding coronavirus which comprises the wild-type replicase gene. enterococci and Clostridium difficile), which may require interruption of treatment (see section 4.8). It is representative of a pathogenic IBV and therefore can be analysed for mutations that cause either loss or reduction in pathogenicity. A protein encoded by a variant coronavirus replicase gene according to claim 12. A coronavirus expressing a variant replicase according to the present invention may cause clinical symptoms, as defined in Table 2, at a lower level than a coronavirus expressing the wild type replicase. Potential nephrotoxic drugs and loop diuretics. Cosentyx, Humira, Otezla, Promacta, Stelara, Taltz, Colazal, Pentasa, Dipentum, Azulfidine. Sperry Journal of Virology, 2005, vol. The disease is characterized by respiratory signs including gasping, coughing, sneezing, tracheal rales, and nasal discharge. Armesto et al., A recombinant avian infectious bronchitis virus expressing a heterologous spike gene belonging to the 4/91 serotype, PLoS One, 6(8):e24352 (2011). However, this should not lead to false-positive results, as may be experienced with some other cephalosporins. (Arch Virol (2009) 154:495-499). IV Replacement Algorithm. Intravenous preparation: Diseases with hyperphosphatemia, hypocalcemia, or hypernatremia. Ther. Oral: 2 mg oral/IV/IM 2 to 3 times a day A therapeutically effective amount of a composition according to the invention may be readily determined by one of ordinary skill in the art. Cefuroxime is excreted by glomerular filtration and tubular secretion. Thus in a first aspect, the present invention provides a live, attenuated coronavirus comprising a variant replicase gene encoding polyproteins comprising a mutation in one or more of non-structural protein(s) (nsp)-10, nsp-14, nsp-15 or nsp-16. An official website of the United States government. Maintenance dose: After a favorable initial response, dose should be decreased in small amounts to the lowest dose that maintains an adequate clinical response; if a positive response is not achieved after a reasonable period of time, alternative therapy should be sought. The design of the experiment is given in Table 4 and the clinical results are given in Table 5. History of severe hypersensitivity (e.g. For example, vaccines with mild strains do not induce protective antibody levels when administered to broiler chickens with maternal antibodies as these strains are neutralized by the maternal antibody pool. For the full list of excipients, see section 6.1. Fine greyish-black powder of such granularity that not more than 0.1 per cent by weight shall remain on a British Standard 410:1969 wire sieve nominal aperture size 150 m and not more than 5 per cent by weight on a British Standard 410:1969 wire sieve nominal aperture size 53 m. The live, attenuated coronavirus of the present invention comprises a variant replicase gene which causes the virus to have reduced pathogenicity compared to a coronavirus expressing the corresponding wild-type gene. (3)For the purposes of paragraph (2) above, free circulation has the same meaning as in Article 9.2 of the Treaty establishing the European Community. Fourth day: 0.75 mg orally twice per day If the variant replicase causes a reduction in viral replication and propagation which is too great, the virus will be neutralised by the maternally-derived antibodies. All flour intended for use in the manufacture of biscuits or pastry except wholemeal, The total quantity of these additives used must not exceed 200 calculated as sulphur dioxide, All flour intended for use in the manufacture of cakes, except wholemeal, All flour, except wholemeal. 0.15 mg/kg oral/IV/IM every 6 hours In a seventh aspect, the present invention provides a vaccine comprising a coronavirus according to the first aspect of the invention and a pharmaceutically acceptable carrier. 2022 Family Practice Notebook, LLC. Cefuroxime may affect the gut flora, leading to lower oestrogen reabsorption and reduced efficacy of combined oral contraceptives. (2)Where an offence under these Regulations is committed in Scotland by a Scottish partnership and is proved to have been committed with the consent or connivance of, or to be attributable to any neglect on the part of, a partner, he as well as the partnership shall be guilty of the offence and be liable to be proceeded against and punished accordingly. Consider add-on low dose oral corticosteroids (CS) (7.5 mg/day or less of prednisone equivalent) only for those with poor symptom control and/or frequent exacerbation despite good inhaler technique and treatment adherence. 2,3,4,10,11 Hydrochlorothiazide has a wide therapeutic window as dosing is individualized and can range from 25-100mg. military, search and rescue at altitudes greater than 3500 m): 4 mg orally every 6 hours. Doses should be titrated based on patient response and severity of the condition; patients should be continuously monitored for signs that may require a dosage adjustment: Consult WARNINGS section for additional precautions. Biotechnol., 98(4):1727-35 (2014). Section 6(4) of the Act was amended by paragraph 6 of Schedule 9 to the Deregulation and Contracting Out Act 1994 (c. 40). Acute exacerbations of chronic bronchitis, Complicated urinary tract infections, including pyelonephritis, Soft-tissue infections: cellulitis, erysipelas and wound infections, Intra-abdominal infections (see section 4.4), Prophylaxis against infection in gastrointestinal (including oesophageal), orthopaedic, cardiovascular, and gynaecological surgery (including caesarean section). 19. For more information see the EUR-Lex public statement on re-use. Typically, a physician or veterinarian will determine the actual dosage which will be most suitable for an individual subject or group of subjects and it will vary with the age, weight and response of the particular subject(s). Alternatively the cell may be capable of producing recombinant coronavirus by a reverse genetics system. It is an isolate used in many labs throughout the world as a pathogenic lab stain and can be obtained from ATCC (VR-21). Compound Sodium Lactate Injection BP (Hartmann's Solution). Pro to Leu at position 85 of SEQ ID NO: 6. Solutions and suspensions range in colour from clear to yellow coloured depending on concentration, diluent and storage conditions used. It also facilitates the administration of a uniform dose per subject, unlike spray inoculation and administration via drinking water. The cell may be able to produce recombinant recombining virus (e.g. Plasmids, or vectors (as they are sometimes known), may be used to express a protein in a host cell. A summary of the functions of coronavirus nsp proteins is provided in Table 1. Reduced pathogenicity in terms of the embryo may mean that the coronavirus causes less reduction in hatchability compared to a corresponding, wild-type control coronavirus. All publications mentioned in the above specification are herein incorporated by reference. A M41-CK full-length cDNA was produced by replacement of the Beaudette cDNA in the Vaccinia virus reverse genetics system previously described in PCT/GB2010/001293 (herein incorporated by reference) with synthetic cDNA derived from the M41 consensus sequence. of officers); section 35(1) to (3) (punishment of offences) in so far as it relates to offences under section 33(1) and (2) as applied by paragraph (g) above; section 36 (offences by bodies corporate); and. It is also to replace phosphate in patients with hypophosphatemia. 79, No. Patients should address specific medical concerns with their physicians. Comments: 40 mg oral/IV on days 1, 8, 15, 22, and repeated every 4 weeks FIG. Before Rat Coronavirus is quite prevalent in Eastern Australia where, as of March/April 2008, it has been found among native and feral rodent colonies. 23. PubMed comprises more than 34 million citations for biomedical literature from MEDLINE, life science journals, and online books. The vaccine may be administered together with one or more other vaccines, for example, vaccines for other diseases, such as Newcastle disease virus (NDV). The disease may be infectious bronchitis (IB); Porcine epidemic diarrhoea; Transmissible gastroenteritis; Mouse hepatitis virus; Porcine haemagglutinating encephalomyelitis; Severe acute respiratory syndrome (SARS); or Bluecomb disease. The stability of cefuroxime sodium in Sodium Chloride Injection BP 0.9% w/v and in 5% Dextrose Injection is not affected by the presence of hydrocortisone sodium phosphate. Two zinc-binding sites have been identified that are formed by conserved cysteine residues and one histidine residue (Cys-74/Cys-77/His-83/Cys-90; Cys-117/Cys-120/Cys-128/Cys-130). Sodium decreased, Grade 3 or 4 (9%) Glucose increased, Grade 3 or 4 (8%) Changes we have not yet applied to the text, can be found in the Changes to Legislation area. The majority of these were synonymous mutations, as the nucleotide change did not affect the amino acid sequence of the protein associated with the sequence. 10. Vials containing an off-white to slightly yellow sterile powder for solution for injection or infusion. on a label, ticket or notice as prescribed by regulation 36 of the labelling regulations, where by virtue of regulation 23 of the labelling regulations the bread is not marked or labelled with a list of ingredients. The pH of 2.74% w/v sodium bicarbonate injection BP considerably affects the colour of solutions and therefore this solution is not recommended for the dilution of Cefuroxime. Aka: Potassium Replacement, Potassium Supplementation, Extended Release Potassium Chloride Tablet, Immediate-Release Potassium Chloride Powder, Potassium Bicarbonate Effervescent Tablet, K-Dur, These images are a random sampling from a Bing search on the term "Potassium Replacement." The nucleotide sequence may comprise the substitutions C12137T and T19047A. Sodium Phosphate, Dibasic, Sodium Phosphate, Monobasic Intravenous Inj Sol DOSAGE & INDICATIONS For use as a bowel evacuant to clean the colon prior to colonoscopy (bowel preparation). A suitable variant replicase may be identified using methods which are known in the art. A decision must be made whether to discontinue breast-feeding or to discontinue/abstain from cefuroxime therapy taking into account the benefit of breast feeding for the child and the benefit of therapy for the woman. Editor/authors are masked to the peer review process and editorial decision-making of their own work and are not able to access this work in the online manuscript submission system. To view the changes to a medicine you must sign up and log in. Gamma glutamyl transpeptidase activity in rat urine is inhibited by various cephalosporins, however the level of inhibition is less with cefuroxime. Cefuroxime sodium for injection is indicated for the treatment of infections listed below in adults and children, including neonates (from birth) (see sections 4.4 and 5.1). Corticosteroids are not indicated as initial treatment for anaphylaxis, but can be given as adjunctive therapy after the administration of epinephrine. The Patent Public Search tool is a new web-based patent search application that will replace internal legacy search tools PubEast and PubWest and external legacy search tools PatFT and AppFT. The virus may also be sensitive to maternally-derived antibodies if the hens were vaccinated with a similar serotype. The impetus of the membership remains research-based academic surgery, and to promote the shared vision of research and academic pursuits through the exchange of ideas between senior surgical residents, junior faculty and established academic The present invention also relates to the use of such a coronavirus in a vaccine to prevent and/or treat a disease. The nucleotide sequence may comprise the substitutions C12137T, T19047A and G20139A. The present invention also provides a vaccine composition comprising a vaccine according to the invention together with one or more other vaccine(s). Comments: Acute exacerbation: 30 mg orally once a day for 1 week followed by 4 to 8 mg orally every other day for 1 month This approach is much more controllable than random attenuation following multiple passages in embryonated eggs because the position of each mutation is known and its effect on the virus, i.e. Cephalosporin antibiotics may, in general, be given safely to patients who are hypersensitive to penicillins, although cross-reactions have been reported. Positive recombinants may then be verified to contain the modified replicase gene by, for example, PCR and sequencing. After reconstitution the product may be stored at 2C-8C (in a refrigerator) for up to 24 hours. Continue typing to refine. The journal presents original contributions as well as a complete international abstracts section and other special departments to provide the most current source of information and references in pediatric surgery.The journal is based on the need to improve the surgical care of infants and children, not only through advances in physiology, pathology and surgical We comply with the HONcode standard for trustworthy health information. In addition the incidence of adverse reactions associated with cefuroxime sodium may vary according to the indication. 17. For example, the DNA from the recombining virus from step (iv) may be inserted into a plasmid and used to transfect cells which express cytoplasmic T7 RNA polymerase. FIG. Because elderly patients are more likely to have decreased renal function, care should be taken in cefuroxime dose selection, and it may be useful to monitor renal function (see section 4.2). Patients should be advised of common adverse reactions including changes in glucose tolerance, high blood pressure, behavioral/mood changes, increased appetite, and weight gain. A variant replicase gene as defined in claim 1. A major challenge associated with in ovo vaccination is that the virus must be capable of replicating in the presence of maternally-derived antibodies against the virus, without being pathogenic to the embryo. Almost two years ago, we launched PubMed Journals, an NCBI Labs project. Molecular Formula, total atoms represented as a molecular structure in a UNII description. Hatchability of the eggs inoculated with IB M41-R was good and chickens were healthy. Thus the term without being pathogenic to the embryo in the context of the present invention may mean without causing reduced hatchability when compared to a control coronavirus. PCT/GB2015/052124, dated Oct. 9, 2015. The coronavirus according to claim 1 wherein the replicase gene encodes a protein comprising the amino acid mutations Val to Leu at the position corresponding to position 393 of SEQ ID NO: 7; Leu to Ile at the position corresponding to position 183 of SEQ ID NO: 8; and Val to Ile at the position corresponding to position 209 of SEQ ID NO: 9. Latest News. The IBV cDNA within recombinant Vaccinia virus (rVV) rVV-BeauR-Rep-M41 structure described in Armesto, Cavanagh and Britton (2009). Therefore, as with all such antibiotics, in patients with markedly impaired renal function it is recommended that the dosage of Cefuroxime should be reduced to compensate for its slower excretion. R. C. Rowe et al, APhA Publications, 2003. NendoU cleaves at the 3 side of uridylate residues in both single-stranded and double-stranded RNA. 750 mg twice daily; for low-flux haemofiltration follow the dosage recommended under impaired renal function. After challenge all surviving chickens after hatch were completely protected against ciliostasis. Usual dose: 2 mg orally every 6 hours OR 4 mg orally every 12 hours, Initial dose: 10 mg IV once, followed by 4 mg IM every 6 hours until maximal response is noted. Overgrowth of non-susceptible microorganisms. Identity comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. The coronavirus according to claim 8, wherein the S1 subunit is from an IBV serotype other than M41. Each replacement cDNA contained approx. The coronavirus according to claim 1 which is IBV M41. Prop 30 is supported by a coalition including CalFire Firefighters, the American Lung Association, environmental organizations, electrical workers and businesses that want to improve Californias air quality by fighting and preventing wildfires and reducing air HNF4A (Hepatocyte Nuclear Factor 4 Alpha) is a Protein Coding gene. Virol., 77(16):9084-9 (2003). Virol., 88(8):4251-64 (2014). 1 The cephalosporin breakpoints for Enterobacteriaceae will detect all clinically important resistance mechanisms (including ESBL and plasmid mediated AmpC). by Jo Chikwe, MD, FRCS, and Brian Mitzman, MD, FACS. The enzyme may be involved in the production of the cap 1 structures of coronavirus RNAs and it may also cooperate with NendoU and ExoN in other RNA processing pathways. section 3 (presumption that food is intended for human consumption); section 20 (offences due to fault of another person); section 21 (defence of due diligence) as it applies for the purposes of section 8, 14 or 15; section 22 (defence of publication in the course of business); section 30(8) (which relates to documentary evidence); section 33 (obstruction etc. 20 mg IV as a single dose followed by IV infusion of 3 mg/kg/24 hours These results confirmed that repair of all four Nsps restored pathogenicity to M41-R; again supporting the previous evidence that the mutations described in the four Nsps are implicated in attenuating M41-CK. Methods, 123(2):203-11 (2005). Applies to the following strengths: 0.25 mg; 0.5 mg; 0.75 mg; 1.5 mg; 4 mg; 6 mg; 0.5 mg/5 mL; 4 mg/mL; 8 mg/mL; 24 mg/mL; 10 mg/mL; 1 mg/mL; 1 mg; 2 mg; 16 mg/mL; sodium phosphate; acetate; 0.1 mg/inh; 10 mg/mL preservative-free; 6 mg/25 mL-NaCl 0.9%; 20 mg, Prevention of AMS and HACE: The biologically relevant substrate(s) of coronavirus NendoUs remains to be identified. 10Position of amino acid mutations in mutated nsp10, nsp14, nsp15 and nsp16 sequences. 11A) Snicking; B) Respiratory symptoms (wheezing and rales combined) and C) Ciliary activity of rIBV M41R-nsp 10,14 rep and rIBV M41R-nsp 10,16 rep compared to M41-CK (Bars show mock, M41R-nsp10,14rep; M41R-nsp10,16rep and M41-K from left to right of each timepoint). Buffers include, without limitation, salts prepared from an organic acid or base. wholemeal flour, be naturally present in the quantities specified in column 2 of that Schedule, and not added; flour other than wholemeal, be added where such addition is necessary in accordance with the conditions prescribed in column 2 of that Schedule. After intramuscular (IM) injection of cefuroxime to normal volunteers, the mean peak serum concentrations ranged from 27 to 35 g/mL for a 750 mg dose and from 33 to 40 g/mL for a 1000 mg dose, and were achieved within 30 to 60 minutes after administration. The resulting IBV cDNA consisted of 5 UTR-Nsp2-Nsp3 from M41, Nsp4-Nsp16 from Beaudette and the structural and accessory genes and 3 UTR from M41. The nucleotide sequence may comprise the substitutions C12137T, G18114C and T19047A. Mouse hepatitis virus (MHV) is a coronavirus that causes an epidemic murine illness with high mortality, especially among colonies of laboratory mice. 1990 c. 16; the Ministers is defined in section 4(1) of the Act. 7.5 to 60 mg PO administered once daily in the morning or as alternate-day therapy as needed for symptom control; use lowest effective dose. 8. When the plasmid is inserted into the vaccinia virus genome, an unstable intermediate is formed. The inventors identified several nucleotide differences in the M41-R compared to the M41-CK sequences. Protect from light. Reproductive studies in animals have shown no effects on fertility. for large broiler flocks. The British Pharmacopoeia 1973, 1980 and 1988 and the British Pharmaceutical Codex 1973, referred to in Schedule 1 may be inspected at the British Library Lending Division Boston Spa, Wetherby, West Yorks LS23 7BQ, Tel. A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nlm.nih.gov). Table 4. ** The resulting volume of the solution/suspension of cefuroxime in reconstitution medium is increased due to the displacement factor of the drug substance resulting in the listed concentrations in mg/ml. Although accurate, these methods can be expensive e.g. Acute mountain sickness/high-altitude cerebral edema (off-label use): Prevention, moderate- to high-risk situations (alternative agent): Note: Use in addition to gradual ascent and start the day of ascent.. Dose will vary according to the degree of inflammation and the size and location of the affected site. The mutant may have at least 70, 80, 90, 95, 98 or 99% sequence identity with the corresponding portion of the wild type sequence. The pharmaceutical compositions may comprise as (or in addition to) the carrier, excipient or diluent, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the delivery or immunogenicity of the virus. Class. A live, attenuated coronavirus comprising a variant replicase gene encoding polyproteins comprising a mutation in one or both of non-structural protein(s) nsp-10 and nsp-14, wherein the variant replicase gene encodes a protein comprising an amino acid mutation of Pro to Leu at the position corresponding to position 85 of SEQ ID NO: 6, and/or wherein the variant replicase gene encodes a protein comprising an amino acid mutation of Val to Leu at the position corresponding to position 393 of SEQ ID NO: 7. When oral therapy is not feasible IV or IM therapy in doses ranging from one-third to one-half the oral dose may be given every 12 hours. (b)in a form conforming to the criteria in the monograph for thiamine hydrochloride contained in the British Pharmacopoeia 1980 at page 451. For instructions on preparation of the medicinal product before administration, see section 6.6. To prevent means to administer the vaccine to a subject who has not yet contracted the disease and/or who is not showing any symptoms of the disease to prevent or impair the cause of the disease (e.g. 2) and some but inconsistent loss in ciliary activity (FIG. Ausubel et al., Short Protocols in Molecular Biology, 4th edition, Chapter 18 (1999). Decadron, Dexamethasone Intensol, Baycadron, De-Sone LA, +4 more. Eight chicks died. As necessary, expert advice should be sought when the local prevalence of resistance is known and the utility of the agent in at least some types of infections is questionable. Casais et al., Reverse genetics system for the avian coronavirus infectious bronchitis virus, J. Cefuroxime is excreted by glomerular filtration and tubular secretion. The easiest way to lookup drug information, identify pills, check interactions and set up your own personal medication records. ESBL detection and characterisation are recommended for public health and infection control purposes. Betamethasone sodium phosphate is a white to practically white, odorless powder, and is hygroscopic. Hydrochlorothiazide prevents the reabsorption of sodium and water from the distal convoluted tubule, allowing for the increased elimination of water in the urine. 6.(1)There shall not be used in the labelling or advertising of bread, as part of the name of the bread, whether or not qualified by other words. The method according to claim 20 wherein the method of administration is selected from the group consisting of; eye drop administration, intranasal administration, drinking water administration, post-hatch injection and in ovo injection. An additional 4-day course may be given if bleeding symptoms are present on day 7 or platelet count remains below 30 x10(9)/L. Cefuroxime is excreted in human milk in small quantities. The stability of cefuroxime sodium in Sodium Chloride Injection BP 0.9% w/v and in 5% Dextrose Injection is not affected by the presence of hydrocortisone sodium phosphate. Nsp-16 has been predicted to mediate ribose-2-O-methyltransferase (2-O-MTase) activity and reverse-genetics experiments have shown that the 2-O-MTase domain is essential for viral RNA synthesis in HCoV-229E and SARS-CoV. European Union - 2022/11/30 Draft Commission Implementing Regulation approving Alkyl C1216 dimethylbenzyl ammonium chloride ADBACBKC C12C16 as an active substance for use in biocidal products of producttype 1 in accordance with Regulation EU No 5282012 of the European Parliament and of the Council. H120 is a commercial live attenuated IBV Massachusetts serotype vaccine strain, attenuated by approximately 120 passages in embryonated chicken eggs. Last updated on Aug 24, 2021. Calculate the total iron in solution as a percentage of the metallic iron content of the sample taken. This allowed insertion of the M41 cDNA sequence by homologous recombination and sequential addition of contiguous M41 replicase gene sequence. (A course of treatment consists of two litres of Moviprep). Patients should be closely monitored for signs requiring dose adjustments; if therapy is to be stopped after more than a few days, it should be gradually withdrawn. significance of matches. Coronaviruses are enveloped viruses with a positive-sense single-stranded RNA genome and a helical symmetry. In case of severe hypersensitivity reactions, treatment with cefuroxime must be discontinued immediately and adequate emergency measures must be initiated. any bread brought into Great Britain from an EEA State in which it was lawfully produced and sold; any flour brought into Great Britain from a member State in which it was lawfully produced and sold; any bread or flour lawfully produced in another member State and brought into Great Britain from a member State in which it was lawfully sold; any bread or flour lawfully produced outside the European Community and brought into Great Britain from a member State in which it was in free circulation and lawfully sold, self-raising flour which has a calcium content of not less than 0.2 per cent, and. Soft tissue infiltration: 2 to 6 mg This page was written by Scott Moses, MD, last revised on 5/2/2021 and last published on 11/30/2022. 0131-650 3685. Click on the image (or right click) to open the source website in a new browser window. When made up for intravenous administration, it may be yellowish. There was no evidence of accumulation of cefuroxime in the serum from normal volunteers following repeat intravenous administration of 1500 mg doses every 8 hours. Non-clinical data reveal no special hazard for humans based on conventional studies of safety pharmacology, repeated dose toxicity, genotoxicity and toxicity to reproduction and development. Concurrent administration of probenecid prolongs the excretion of cefuroxime and produces an elevated peak serum level. Due to its spectrum of activity, cefuroxime is not suitable for the treatment of infections caused by Gram-negative non-fermenting bacteria (see section 5.1). Determination of blood/plasma glucose levels: Please refer to section 4.4. National Library of Medicine Cefuroxime should not be mixed in the syringe with aminoglycoside antibiotics. The coronavirus according to claim 1, further comprising a mutation in one or both of nsp-15 and nsp-16. To be taken into consideration by patients on a controlled sodium diet. M41-K (in which all four mutations had been repaired) resulted in clinical signs and 100% loss of ciliary activity (complete ciliostasis) by 4 days post-infection (FIGS. The variant replicase gene may encode a protein which comprises the amino acid mutations Pro to Leu at position 85 of SEQ ID NO: 6, Val to Leu at position 393 of SEQ ID NO: 7 and Leu to Ile at position 183 of SEQ ID NO: 8. 2 Dispensable for MHV and SARS-CoV replication in tissue culture 3 Acidic domain; macro domain with ADRP and poly (ADP-ribose)-binding activities; one or two ZBD- containing papain-like proteases; Y domain 4 Transmembrane domain 5 3C-like main protease, homodimer 6 Transmembrane domain 7 Interacts with nsp8 to form a hexadecamer complex 8 Noncannonical RNA polymerase; interacts with nsp7 to form a hexadecameric complex 9 ssRNA-binding protein, dimer 10 RNA-binding protein, homododecamer, zinc-binding domain, known to interact with nsp14 and nsp16 11 Unknown 12 RNA-dependent RNA polymerase 13 Zinc-binding domain, NTPase, dNTPase, 5-to-3 RNA and DNA helicase, RNA 5-triphosphate 14 3-to 5 exoribonuclease, zinc-binding domain and N7- methyltransferase 15 Uridylate-specific endoribonuclease, homohexamer 16 Putative ribose-2-O-methyltransferase. It is freely soluble in water and in methanol, but is practically insoluble in acetone and in chloroform.. Betamethasone acetate is a white to creamy white, odorless powder that sinters and resolidifies at about 165C, and remelts at about 200C-220C with decomposition. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other: ALIPHATIC Non-polar GAP ILV Polar-uncharged CSTM NQ Polar-charged DE KR AROMATIC HFWY. government site. A live, attenuated virus is a weakened replicating virus still capable of stimulating an immune response and producing immunity but not causing the actual illness. The genome sequence of IBV M41-CK is provided as SEQ ID NO: 1. Pharmacokinetics. (3)Notwithstanding regulation 17 of the labelling regulations, where a flour treatment agent has been used as an ingredient of any bread an indication of the presence of flour treatment agent shall appear, (a)in the list of ingredients of the bread as prescribed by regulation 14 of the labelling regulations, where the bread is marked or labelled with a list of ingredients; or. FIG. The following provisions of the Act shall apply for the purposes of these Regulations and unless the context otherwise requires any reference in them to the Act or Part thereof shall be construed as a reference to these Regulations. Coronaviruses also cause a range of diseases in livestock animals and domesticated pets, some of which can be serious and are a threat to the farming industry. All flour used in the manufacture of biscuits, except wholemeal or flour to which E220 Sulphur dioxide or E223 Sodium metabisulphite has been added, Other flour, except wholemeal. The genomic and protein sequences for nsp-10, -14, -15 and -16 are provided as SEQ ID NO: 2-5 and 6-9, respectively. Vaccination may be by in ova vaccination. The present invention also relates to a method for producing such a vaccine which comprises the step of infecting cells, for example Vero cells, with a viral particle comprising a replicase protein as defined in connection with the first aspect of the invention. Accurately weigh 0.25 g of sample into a stoppered flask. The long duration of action of this drug makes it unsuitable for alternate-day-therapy. (a)All flour used in the manufacture of biscuits, except wholemeal or flour to which E220 Sulphur dioxide or E223 Sodium metabisulphite has been added, (b)Other flour, except wholemeal. Discontinuation of therapy with cefuroxime and the administration of specific treatment for Clostridium difficile should be considered. No. Adderall tablets contain d-amphetamine and l-amphetamine salts in the ratio of 3:1. The S glycoprotein consists of four domains: a signal sequence that is cleaved during synthesis; the ectodomain, which is present on the outside of the virion particle; the transmembrane region responsible for anchoring the S protein into the lipid bilayer of the virion particle; and the cytoplasmic tail. However such viruses almost always show an increased virulence to embryos and therefore cannot be used for in ova vaccination as they cause reduced hatchability. 2Clinical signs, snicking and wheezing, associated with M41-R-6 and M41-R-12 compared to M41-CK (M41 EP4) and Beau-R (Bars show mock, Beau-R, M41-R 6, M41-R 12, M41-CK EP4 from left to right of each timepoint). The most publicized human coronavirus, SARS-CoV which causes severe acute respiratory syndrome (SARS), has a unique pathogenesis because it causes both upper and lower respiratory tract infections and can also cause gastroenteritis. (i)ferric ammonium citrate conforming to the criteria in the monograph for ferric ammonium citrate contained in the British Pharmacopoeia 1973 at page 201; (ii)green ferric ammonium citrate conforming to the criteria for ammonium ferric citrate contained in the British Pharmaceutical Codex 1973 at page 194; (iii)ferrous sulphate conforming to the criteria in the monograph for ferrous sulphate contained in the British Pharmacopoeia 1988 at page 245; (iv)dried ferrous sulphate conforming to the criteria in the monograph for dried ferrous sulphate contained in the British Pharmacopoeia 1988 at page 245; (v)iron powder conforming to the description, specification and requirements contained in Schedule 2. SARS-CoV ExoN has been demonstrated to have metal ion-dependent 3-to-5 exoribonuclease activity that acts on both single-stranded and double-stranded RNA, but not on DNA. Bursae: 2 to 4 mg While developing vaccines to be administered in ovo to chicken embryos, attention must be paid to two points: the effect of maternal antibodies on the vaccines and the effect of the vaccines on the embryo. The composition may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. the presence or absence of an ESBL does not in itself influence the categorization of susceptibility. Both rIBVs showed increased pathogenicity when compared to M41-R but not to the level observed with M41-CK (FIGS. Enter organism common name, scientific name, or tax id. 4 and 5). To be useful for in ovo vaccination, the virus must also not replicate and propagate at a level which causes it to be pathogenic to the embryo. 11a-c). The variant replicase gene may encode a protein which comprises the amino acid mutation Pro to Leu at position 85 of SEQ ID NO: 6. The Association for Academic Surgery is widely recognized as an inclusive surgical organization. A method for producing a vaccine according to claim 19, which comprises the step of infecting a cell according to claim 18 with a coronavirus according to claim 1. The results of the ciliostasis test are given in Table 6. For single use. The program compares nucleotide or The vaccine or vaccine composition of the invention may be used to treat a human, animal or avian subject. Clinical signs of IB include sneezing, tracheal rales, nasal discharge and wheezing. The variant replicase gene may encode a protein comprising one or more amino acid mutations selected from the list of: The replicase gene may encode a protein comprising the amino acid mutation Pro to Leu at position 85 of SEQ ID NO: 6. Further aspects of the invention provide: The disease may be infectious bronchitis (IB). Pantoprazole sodium sesquihydrate is a white to off-white crystalline powder and is racemic. 24. The replicase gene may encodes a protein comprising the amino acid mutations Pro to Leu at position 85 of SEQ ID NO: 6; Val to Leu at position 393 of SEQ ID NO:7; Leu to Ile at position 183 of SEQ ID NO:8; and Val to Ile at position 209 of SEQ ID NO: 9. Accurately weigh 0.1 g of sample into a 750 ml conical flask. In addition to the structural and accessory genes, two-thirds of a coronavirus genome comprises the replicase gene (at the 5 end of the genome), which is expressed as two polyproteins, pp1a and pp1ab, in which pp1ab is an extension product of pp1a as a result of a 1 ribosomal shift mechanism. The variant replicase gene may encode a protein which comprises the amino acid mutations Pro to Leu at position 85 of SEQ ID NO: 6 Leu to Ile at position 183 of SEQ ID NO: 8. Help us improve emc by letting us know which of the following best describes you, 2. However, if required, for patients receiving sodium bicarbonate injection by infusion the Cefuroxime solution may be introduced into the tube of the giving set. The third indication for sampling is to monitor a potentially hazardous environmental condition, confirm the presence of a hazardous chemical or biological agent, and validate the successful abatement of the hazard. sharing sensitive information, make sure youre on a federal If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password The variant replicase gene may encode a protein which comprises the amino acid mutations Pro to Leu at position 85 of SEQ ID NO: 6 Leu to Ile at position 183 of SEQ ID NO: 8 and Val to Ile at position 209 of SEQ ID NO: 9. This may be supplemented with two 750 mg doses (intramuscularly) after 8 hours and 16 hours. The term replicase protein is used herein to refer to the pp1a and pp1ab polyproteins or individual nsp subunits. A coronavirus expressing a variant replicase according to the present invention may cause wheezing in less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20% or less than 10% of the number of birds in a flock infected with the a virus expressing the wild type replicase. 2. Alternatives include spray inoculation of administration to drinking water but it can be difficult to ensure uniform vaccine application using such methods. Suggested doses: The recombinant vaccinia virus (rVV) may be made using a vaccinia-virus based reverse genetics system. Suitable reverse genetics systems are known in the art (Casais et al (2001) J. Virol 75:12359-12369; Casais et al (2003) J. Virol. Cefuroxime powder for solution for injection and infusion contains 40.6 mg sodium per 750mg vial, equivalent to 2% of the WHO recommended maximum daily intake of 2 g sodium for an adult. The genome of the coronavirus strain may lack the part of the replicase protein corresponding to the part provided by the plasmid, so that a modified protein is formed through insertion of the nucleotide sequence provided by the plasmid. Infants and toddlers > 3 weeks and children < 40 kg, 30 to 100 mg/kg/day (intravenously) given as 3 or 4 divided doses; a dose of 60 mg/kg/day is appropriate for most infections, 30 to 100 mg/kg/day (intravenously) given as 2 or 3 divided doses (see section 5.2), Soft-tissue infections: cellulitis, erysipelas and wound infections. in a 250 mL 0.9% sodium chloride infusion bag. Articles report on outcomes research, prospective studies, and controlled trials of new endoscopic instruments and treatment methods. A method for making the coronavirus according to claim 1 which comprises the following steps: 16. All bread, except wholemeal, (This note is not part of the Regulations). There are no data on the effects of cefuroxime sodium on fertility in humans. Comments: Meningitis (H. influenzae type b): Short-term high-dose corticosteroids are an accepted standard of care for treating relapses of multiple sclerosis; chronic daily corticosteroids are not recommended. In the ciliostasis test after challenge it appeared that all chickens vaccinated in ovo with IB M41-R were protected, whereas none of the controls was protected, see Table 9. Oral: 2 mg every 6 hours or 4 mg every 12 hours; may be discontinued after staying at the same elevation for 2 to 4 days or if descent is initiated. No changes have been applied to the text. Loss of ciliary activity is a well-established method for determining the pathogenicity of IBV. However, in older infants (aged >3 weeks) and in children, the serum half-life of 60 to 90 minutes is similar to that observed in adults. 01937 546 060 and by appointment at the library of the Ministry of Agriculture, Fisheries and Food, 3 Whitehall Place, London SW1A 2HH, Tel. those occurring at <1/10,000) were mainly determined using post-marketing data, and refer to a reporting rate rather than a true frequency. The preparation of these pharmaceutically acceptable compositions, from the above-described components, having appropriate pH isotonicity, stability and other conventional characteristics is within the skill of the art. 5 Breakpoints apply to daily intravenous dose of 750 mg 3 and a high dose of at least 1.5 g 3. Each vial contains, as the active ingredient, cefuroxime sodium for injection equivalent to 750mg of cefuroxime. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology, virology or related fields are intended to be within the scope of the following claims. The most common adverse reactions are neutropenia, eosinophilia, transient rise in liver enzymes or bilirubin, particularly in patients with pre-existing liver disease, but there is no evidence of harm to the liver and injection site reactions. The variant replicase gene may encode a protein which comprises the amino acid mutations Pro to Leu at position 85 of SEQ ID NO: 6, Val to Leu at position 393 of SEQ ID NO: 7 and Val to Ile at position 209 of SEQ ID NO: 9. The variant replicase gene encoded by the coronavirus of the present invention comprises a mutation in one or more of the sections of sequence encoding nsp-10, nsp-14, nsp-15 or nsp-16. The variant coronavirus replicase gene encodes a protein comprising a mutation in one or more of non-structural protein (nsp)-10, nsp-14, nsp-15 or nsp-16 when compared to the wild-type sequence of the non-structural protein. 7.(1)If any person contravenes or fails to comply with regulation 4(4), 5 or 6(2) he shall be guilty of an offence and liable on summary conviction to a fine not exceeding level 5 on the standard scale. To email a medicine you must sign up and log in. In keeping with good pharmaceutical practice, freshly constituted suspensions or solutions should be used immediately. Additionally, it may be considered in patients with chronic immune thrombocytopenia as an alternative to splenectomy or in patients who do not response to splenectomy. IBVM41-CKSequence SEQIDNO:1 ACTTAAGATAGATATTAATATATATCTATCACACTAGCCTTGCGCTAGATTTCCAACTTA ACAAAACGGACTTAAATACCTACAGCTGGTCCTCATAGGTGTTCCATTGCAGTGCACTTT AGTGCCCTGGATGGCACCTGGCCACCTGTCAGGTTTTTGTTATTAAAATCTTATTGTTGC TGGTATCACTGCTTGTTTTGCCGTGTCTCACTTTATACATCCGTTGCTTGGGCTACCTAG TATCCAGCGTCCTACGGGCGCCGTGGCTGGTTCGAGTGCGAAGAACCTCTGGTTCATCTA GCGGTAGGCGGGTGTGTGGAAGTAGCACTTCAGACGTACCGGTTCTGTTGTGTGAAATAC GGGGTCACCTCCCCCCACATACCTCTAAGGGCTTTTGAGCCTAGCGTTGGGCTACGTTCT CGCATAAGGTCGGCTATACGACGTTTGTAGGGGGTAGTGCCAAACAACCCCTGAGGTGAC AGGTTCTGGTGGTGTTTAGTGAGCAGACATACAATAGACAGTGACAACATGGCTTCAAGC CTAAAACAGGGAGTATCTGCGAAACTAAGGGATGTCATTGTTGTATCCAAAGAGATTGCT GAACAACTTTGTGACGCTTTGTTTTTCTATACGTCACACAACCCTAAGGATTACGCTGAT GCTTTTGCAGTTAGGCAGAAGTTTGATCGTAATCTGCAGACTGGGAAACAGTTCAAATTT GAAACTGTGTGTGGTCTCTTCCTCTTGAAGGGAGTTGACAAAATAACACCTGGCGTCCCA GCAAAAGTCTTAAAAGCCACTTCTAAGTTGGCAGATTTAGAAGACATCTTTGGTGTCTCT CCCTTTGCAAGAAAATATCGTGAACTTTTGAAGACAGCATGCCAGTGGTCTCTTACTGTA GAAACACTGGATGCTCGTGCACAAACTCTTGATGAAATTTTTGACCCTACTGAAATACTT TGGCTTCAGGTGGCAGCAAAAATCCAAGTTTCGGCTATGGCGATGCGCAGGCTTGTTGGA GAAGTAACTGCAAAAGTCATGGATGCTTTGGGCTCAAATATGAGTGCTCTTTTCCAGATT TTTAAACAACAAATAGTCAGAATTTTTCAAAAAGCGCTGGCTATTTTTGAGAATGTGAGT GAATTACCACAGCGTATTGCAGCACTTAAGATGGCTTTTGCTAAGTGTGCCAAGTCCATT ACTGTTGTGGTTATGGAGAGGACTCTAGTTGTTAGAGAGTTCGCAGGAACTTGTCTTGCA AGCATTAATGGTGCTGTTGCAAAATTCTTTGAAGAACTCCCAAATGGTTTCATGGGTGCT AAAATTTTCACTACACTTGCCTTCTTTAGGGAGGCTGCAGTGAAAATTGTGGATAACATA CCAAATGCACCGAGAGGCACTAAAGGGTTTGAAGTCGTTGGTAATGCCAAAGGTACACAA GTTGTTGTGCGTGGCATGGGAAATGACTTAACACTGGTTGAGCAAAAAGCTGAAATTGCT GTGGAGTCAGAAGGTTGGTCTGCAATTTTGGGTGGACATCTTTGCTATGTCTTTAAGAGT GGTGATCGCTTTTACGCGGCACCTCTTTCAGGAAATTTTGCATTGCATGATGTGCATTGT TGTGAGCGTGTTGTCTGTCTTTCTGATGGTGTAACACCGGAGATAAATGATGGACTTATT CTTGCAGCAATCTACTCTTCTTTTAGTGTCGCAGAACTTGTGGCAGCCATTAAAAGGGGT GAACCATTTAAGTTTCTGGGTCATAAATTTGTGTATGCAAAGGATGCAGCAGTTTCTTTT ACATTAGCGAAGGCTGCTACTATTGCAGATGTTTTGAAGCTGTTTCAATCAGCGCGTGTG AAAGTAGAAGATGTTTGGTCTTCACTTACTGAAAAGTCTTTTGAATTCTGGAGGCTTGCA TATGGAAAAGTGCGTAATCTCGAAGAATTTGTTAAGACTTGTTTTTGTAAGGCTCAAATG GCGATTGTGATTTTAGCGACAGTGCTTGGAGAGGGCATTTGGCATCTTGTTTCGCAAGTC ATCTATAAAGTAGGTGGTCTTTTTACTAAAGTTGTTGACTTTTGTGAAAAATATTGGAAA GGTTTTTGTGCACAGTTGAAAAGAGCTAAGCTCATTGTCACTGAAACCCTCTGTGTTTTG AAAGGAGTTGCACAGCATTGTTTTCAACTATTGCTGGATGCAATACAGTTTATGTATAAA AGTTTTAAGAAGTGTGCACTTGGTAGAATCCATGGAGACTTGCTCTTCTGGAAAGGAGGT GTGCACAAAATTATTCAAGAGGGCGATGAAATTTGGTTTGAGGGCATTGATAGTATTGAT GTTGAAGATCTGGGTGTTGTTCAAGAAAAATTGATTGATTTTGATGTTTGTGATAATGTG ACACTTCCAGAGAACCAACCCGGTCATATGGTTCAAATCGAGGATGACGGAAAGAACTAC ATGTTCTTCCGCTTCAAAAAGGATGAGAACATTTATTATACACCAATGTCACAGCTTGGT GCTATTAATGTGGTTTGCAAAGCAGGCGGTAAAACTGTCACCTTTGGAGAAACTACTGTG CAAGAAATACCACCACCTGATGTTGTGTTTATTAAGGTTAGCATTGAGTGTTGTGGTGAA CCATGGAATACAATCTTCAAAAAGGCTTATAAGGAGCCCATTGAAGTAGAGACAGACCTC ACAGTTGAACAATTGCTCTCTGTGGTCTATGAGAAAATGTGTGATGATCTCAAGCTGTTT CCGGAGGCTCCAGAACCACCACCATTTGAGAATGTCACACTTGTTGATAAGAATGGTAAA GATTTGGATTGCATAAAATCATGCCATCTGATCTATCGTGATTATGAGAGCGATGATGAC ATCGAGGAAGAAGATGCAGAAGAATGTGACACGGATTCAGGTGATGCTGAGGAGTGTGAC ACTAATTCAGAATGTGAAGAAGAAGATGAGGATACTAAAGTGTTGGCTCTTATACAAGAC CCGGCAAGTAACAAATATCCTCTGCCTCTTGATGATGATTATAGCGTCTACAATGGATGT ATTGTTCATAAGGACGCTCTCGATGTTGTGAATTTACCATCTGGTGAAGAAACCTTTGTT GTCAATAACTGCTTTGAAGGGGCTGTTAAAGCTCTTCCGCAGAAAGTTATTGATGTTCTA GGTGACTGGGGTGAGGCTGTTGATGCGCAAGAACAATTGTGTCAACAAGAATCAACTCGG GTCATATCTGAGAAATCAGTTGAGGGTTTTACTGGTAGTTGTGATGCAATGGCTGAACAA GCTATTGTTGAAGAGCAGGAAATAGTACCTGTTGTTGAACAAAGTCAGGATGTAGTTGTT TTTACACCTGCAGACCTAGAAGTTGTTAAAGAAACAGCAGAAGAGGTTGATGAGTTTATT CTCATTTCTGCTGTCCCTAAAGAAGAAGTTGTGTCTCAGGAGAAAGAGGAGCCACAGGTT GAGCAAGAGCCTACCCTAGTTGTTAAAGCACAACGTGAGAAGAAGGCTAAAAAGTTCAAA GTTAAACCAGCTACATGTGAAAAACCCAAATTTTTGGAGTACAAAACATGTGTGGGTGAT TTGGCTGTTGTAATTGCCAAAGCATTGGATGAGTTTAAAGAGTTCTGCATTGTAAACGCT GCAAATGAGCACATGTCGCATGGTGGTGGCGTTGCAAAGGCAATTGCAGACTTTTGTGGA CCGGACTTTGTTGAATATTGCGCGGACTATGTTAAGAAACATGGTCCACAGCAAAAACTT GTCACACCTTCATTTGTTAAAGGCATTCAATGTGTGAATAATGTTGTAGGACCTCGCCAT GGAGACAGCAACTTGCGTGAGAAGCTTGTTGCTGCTTACAAGAGTGTTCTTGTAGGTGGA GTGGTTAACTATGTTGTGCCAGTTCTCTCATCAGGGATTTTTGGTGTAGATTTTAAAATA TCAATAGATGCTATGCGCGAAGCTTTTAAAGGTTGTGCCATACGCGTTCTTTTATTTTCT CTGAGTCAAGAACACATCGATTATTTCGATGCAACTTGTAAGCAGAAGACAATTTATCTT ACGGAGGATGGTGTTAAATACCGCTCTGTTGTTTTAAAACCTGGTGATTCTTTGGGTCAA TTTGGACAGGTTTTTGCAAGAAATAAGGTAGTCTTTTCGGCTGATGATGTTGAGGATAAA GAAATCCTCTTTATACCCACAACTGACAAGACTATTCTTGAATATTATGGTTTAGATGCG CAAAAGTATGTAACATATTTGCAAACGCTTGCGCAGARATGGGATGTTCAATATAGAGAC AATTTTGTTATATTAGAGTGGCGTGACGGAAATTGCTGGATTAGTTCAGCAATAGTTCTC CTTCAAGCTGCTAAAATTAGATTTAAAGGTTTTCTTGCAGAAGCATGGGCTAAACTGTTG GGTGGAGATCCTACAGACTTTGTTGCCTGGTGTTATGCAAGTTGCAATGCTAAAGTAGGT GATTTTTCAGATGCTAATTGGCTTTTGGCCAATTTAGCAGAACATTTTGACGCAGATTAC ACAAATGCACTTCTTAAGAAGTGTGTGTCGTGCAATTGTGGTGTTAAGAGTTATGAACTT AGGGGTCTTGAAGCCTGTATTCAGCCAGTTCGAGCACCTAATCTTCTACATTTTAAAACG CAATATTCAAATTGCCCAACCTGTGGTGCAAGTAGTACGGATGAAGTAATAGAAGCTTCA TTACCGTACTTATTGCTTTTTGCTACTGATGGTCCTGCTACAGTTGATTGTGATGAAAAT GCTGTAGGGACTGTTGTTTTCATTGGCTCTACTAATAGTGGCCATTGTTATACACAAGCC GATGGTAAGGCTTTTGACAATCTTGCTAAGGATAGAAAATTTGGAAGGAAGTCGCCTTAC ATTACAGCAATGTATACACGTTTTTCTCTTAGGAGTGAAAATCCCCTACTTGTTGTTGAA CATAGTAAGGGTAAAGCTAAAGTAGTAAAAGAAGATGTTTCTAACCTTGCTACTAGTTCT AAAGCCAGTTTTGACGATCTTACTGACTTTGAACACTGGTATGATAGCAACATCTATGAG AGTCTTAAAGTGCAGGAGACACCTGATAATCTTGATGAATATGTGTCATTTACGACAAAG GAAGATTCTAAGTTGCCACTGACACTTAAAGTTAGAGGTATCAAATCAGTTGTTGACTTT AGGTCTAAGGATGGTTTTACTTATAAGTTAACACCTGATACTGATGAAAATTCAAAAACA CCAGTCTACTACCCAGTCTTGGATTCTATTAGTCTTAGGGCAATATGGGTTGAAGGCAGT GCTAATTTTGTTGTTGGGCATCCAAATTATTATAGTAAGTCTCTCCGAATTCCCACGTTT TGGGAAAATGCCGAGAGCTTTGTTAAAATGGGTTATAAAATTGATGGTGTAACTATGGGC CTTTGGCGTGCAGAACACCTTAATAAACCTAATTTGGAGAGAATTTTTAACATTGCTAAG AAAGCTATTGTTGGATCTAGTGTTGTTACTACGCAGTGTGGTAAAATACTAGTTAAAGCA GCTACATACGTTGCCGATAAAGTAGGTGATGGTGTAGTTCGCAATATTACAGATAGAATT AAGGGTCTTTGTGGATTCACACGTGGCCATTTTGAAAAGAAAATGTCCCTACAATTTCTA AAGACACTTGTGTTCTTTTTCTTTTATTTCTTAAAGGCTAGTGCTAAGAGTTTAGTTTCT AGCTATAAGATTGTGTTATGTAAGGTGGTGTTTGCTACCTTACTTATAGTGTGGTTTATA TACACAAGTAATCCAGTAGTGTTTACTGGAATACGTGTGCTAGACTTCCTATTTGAAGGT TCTTTATGTGGTCCTTATAATGACTACGGTAAAGATTCTTTTGATGTGTTACGGTATTGT GCAGGTGATTTTACTTGTCGTGTGTGTTTACATGATAGAGATTCACTTCATCTGTACAAA CATGCTTATAGCGTAGAACAAATTTATAAGGATGCAGCTTCTGGCATTAACTTTAATTGG AATTGGCTTTATTTGGTCTTTCTAATATTATTTGTTAAGCCAGTGGCAGGTTTTGTTATT ATTTGTTATTGTGTTAAGTATTTGGTATTGAGTTCAACTGTGTTGCAAACTGGTGTAGGT TTTCTAGATTGGTTTGTAAAAACAGTTTTTACCCATTTTAATTTTATGGGAGCGGGATTT TATTTCTGGCTCTTTTACAAGATATACGTACAAGTGCATCATATATTGTACTGTAAGGAT GTAACATGTGAAGTGTGCAAGAGAGTTGCACGCAGCAACAGGCAAGAGGTTAGCGTTGTA GTTGGTGGACGCAAGCAAATAGTGCATGTTTACACTAATTCTGGCTATAACTTTTGTAAG AGACATAATTGGTATTGTAGAAATTGTGATGATTATGGTCACCAAAATACATTTATGTCC CCTGAAGTTGCTGGCGAGCTTTCTGAAAAGCTTAAGCGCCATGTTAAACCTACAGCATAT GCTTACCACGTTGTGTATGAGGCATGCGTGGTTGATGATTTTGTTAATTTAAAATATAAG GCTGCAATTGCTGGTAAGGATAATGCATCTTCTGCTGTTAAGTGTTTCAGTGTTACAGAT TTTTTAAAGAAAGCTGTTTTTCTTAAGGAGGCATTGAAATGTGAACAAATATCTAATGAT GGTTTTATAGTGTGTAATACACAGAGTGCGCATGCACTAGAGGAAGCAAAGAATGCAGCC GTCTATTATGCGCAATATCTGTGTAAGCCAATACTTATACTTGACCAGGCACTTTATGAG CAATTAATAGTAGAGCCTGTGTCTAAGAGTGTTATAGATAAAGTGTGTAGCATTTTGTCT AATATAATATCTGTAGATACTGCAGCTTTAAATTATAAGGCAGGCACACTTCGTGATGCT CTGCTTTCTATTACTAAAGACGAAGAAGCCGTAGATATGGCTATCTTCTGCCACAATCAT GAAGTGGAATACACTGGTGACGGTTTTACTAATGTGATACCGTCATATGGTATGGACACT GATAAGTTGACACCTCGTGATAGAGGGTTTTTGATAAATGCAGATGCTTCTATTGCTAAT TTAAGAGTCAAAAATGCTCCTCCGGTAGTATGGAAGTTTTCTGATCTTATTAAATTGTCT GACAGTTGCCTTAAATATTTAATTTCAGCTACTGTCAAGTCAGGAGGTCGTTTCTTTATA ACAAAGTCTGGTGCTAAACAAGTTATTTCTTGTCATACCCAGAAACTGTTGGTAGAGAAA AAGGCAGGTGGTGTTATTAATAACACTTTTAAATGGTTTATGAGTTGTTTTAAATGGCTT TTTGTCTTTTATATACTTTTTACAGCATGTTGTTTGGGTTACTACTATATGGAGATGAAT AAAAGTTTTGTTCACCCCATGTATGATGTAAACTCCACACTGCATGTTGAAGGGTTCAAA GTTATAGACAAAGGTGTTATTAGAGAGATTGTGTCAGAAGATAATTGTTTCTCTAATAAG TTTGTTAATTTTGACGCCTTTTGGGGTAAATCATATGAAAATAATAAAAACTGTCCAATT GTTACAGTTGTTATAGATGGTGACGGGACAGTAGCTGTTGGTGTTCCTGGTTTTGTATCA TGGGTTATGGATGGTGTTATGTTTGTGCATATGACACAGACTGATCGTAGACCTTGGTAC ATTCCTACCTGGTTTAATAGAGAAATTGTTGGTTACACTCAGGATTCAATTATCACTGAG GGTAGTTTTTATACATCTATAGCATTATTTTCTGCTAGATGTTTATATTTAACAGCCAGC AATACACCTCAATTGTATTGTTTTAATGGCGACAATGATGCACCTGGAGCCTTACCATTT GGTAGTATTATTCCTCATAGAGTATACTTCCAACCTAATGGTGTTAGGCTTATAGTTCCA CAACAAATACTGCATACACCCTACATAGTGAAGTTTGTTTCAGACAGCTATTGTAGAGGT AGTGTATGTGAGTATACTAAACCAGGTTACTGTGTGTCACTAGACTCCCAATGGGTTTTG TTTAATGATGAATACATTAGTAAACCTGGCGTTTTCTGTGGTTCTACTGTTAGAGAACTT ATGTTTAATATGGTTAGTACATTCTTTACTGGTGTCAACCCTAATATTTATATTCAGCTA GCAACTATGTTTTTAATACTAGTTGTTATTGTGTTAATTTTTGCAATGGTTATAAAGTTT CAAGGTGTTTTTAAAGCTTATGCGACCATTGTGTTTACAATAATGTTAGTTTGGGTTATT AATGCATTTGTTTTGTGTGTACATAGTTATAATAGTGTTTTAGCTGTTATATTATTAGTA CTCTATTGCTATGCATCATTGGTTACAAGTCGCAATACTGCTATAATAATGCATTGTTGG CTTGTTTTTACCTTTGGTTTAATAGTACCCACATGGTTGGCTTGTTGCTATCTGGGATTT ATTCTTTATATGTACACACCGTTGGTTTTCTGGTGTTACGGTACTACTAAAAATACTCGT AAGTTGTATGATGGCAACGAGTTTGTTGGTAATTATGACCTTGCTGCGAAGAGCACTTTT GTTATTCGTGGTACTGAATTTGTTAAGCTTACGAATGAGATAGGTGATAAATTTGAAGCC TATCTTTCTGCGTATGCTAGACTTAAATACTATTCAGGCACTGGTAGTGAGCAAGATTAC TTGCAAGCTTGTCGTGCATGGTTAGCTTATGCTTTGGACCAATATAGAAATAGTGGTGTT GAGGTTGTTTATACCCCACCGCGTTACTCTATTGGTGTTAGTAGACTACACGCTGGTTTT AAAAAACTAGTTTCTCCTAGTAGTGCTGTTGAGAAGTGCATTGTTAGTGTCTCTTATAGA GGCAATAATCTTAATGGACTGTGGCTGGGTGATTCTATTTACTGCCCACGCCATGTGTTA GGTAAGTTTAGTGGTGACCAGTGGGGTGACGTACTAAACCTTGCTAATAATCATGAGTTT GAAGTTGTAACTCAAAATGGTGTTACTTTGAATGTTGTCAGCAGGCGGCTTAAAGGAGCA GTTTTAATTTTACAAACTGCAGTTGCCAATGCTGAAACTCCTAAGTATAAGTTTGTTAAA GCTAATTGTGGTGATAGTTTCACTATAGCTTGTTCTTATGGTGGTACAGTTATAGGACTT TACCCTGTCACTATGCGTTCTAATGGTACTATTAGAGCATCTTTCCTAGCAGGAGCCTGT GGCTCAGTTGGTTTTAATATAGAAAAGGGTGTAGTTAATTTCTTTTATATGCACCATCTT GAGTTACCTAATGCATTACACACTGGAACTGACCTAATGGGTGAGTTTTATGGTGGTTAT GTAGATGAAGAGGTTGCGCAAAGAGTGCCACCAGATAATCTAGTTACTAACAATATTGTA GCATGGCTCTATGGGGCAATTATTAGTGTTAAAGAAAGTAGTTTTTCACAACCTAAATGG TTGGAGAGTACTACTGTTTCTATTGAAGATTACAATAGGTGGGCTAGTGATAATGGTTTT ACTCCATTTTCCACTAGTACTGCTATTACTAAATTAAGTGCTATAACTGGGGTTGATGTT TGTAAACTCCTTCGCACTATTATGGTAAAAAGTGCTCAATGGGGTAGTGATCCCATTTTA GGACAATATAATTTTGAAGACGAATTGACACCAGAATCTGTATTTAATCAAGTTGGTGGT GTTAGGTTACAGTCTTCTTTTGTAAGAAAAGCTACATCTTGGTTTTGGAGTAGATGTGTA TTAGCTTGCTTCTTGTTTGTGTTGTGTGCTATTGTCTTATTTACGGCAGTGCCACTTAAG TTTTATGTACATGCAGCTGTTATTTTGTTGATGGCTGTGCTCTTTATTTCTTTTACTGTT AAACATGTTATGGCATACATGGACACTTTCCTATTGCCTACATTGATTACAGTTATTATT GGAGTTTGTGCTGAAGTCCCTTTCATATACAATACTCTAATTAGTCAAGTTGTTATTTTC TTAAGCCAATGGTATGATCCTGTAGTCTTTGATACTATGGTACCATGGATGTTATTGCCA TTAGTGTTGTACACTGCTTTTAAGTGTGTACAAGGCTGCTATATGAATTCTTTCAATACT TCTTTGTTAATGCTGTATCAGTTTATGAAGTTAGGTTTTGTTATTTACACCTCTTGAAAC ACTCTTACTGCATATACAGAAGGTAATTGGGAGTTATTCTTTGAGTTGGTTCACACTATT GTGTTGGCTAATGTTAGTAGTAATTCCTTAATTGGTTTAATTGTTTTTAAGTGTGCTAAG TGGATTTTATATTATTGCAATGCAACATACTTTAATAATTATGTGTTAATGGCAGTCATG GTTAATGGCATAGGCTGGCTTTGCACCTGTTACTTTGGATTGTATTGGTGGGTTAATAAA GTTTTTGGTTTAACCTTAGGTAAATACAATTTTAAAGTTTCAGTAGATCAATATAGGTAT ATGTGTTTGCATAAGGTAAATCCACCTAAAACTGTGTGGGAGGTCTTTACTACAAATATA CTTATACAAGGAATTGGAGGCGATCGTGTGTTGCCTATAGCTACAGTGCAATCTAAATTG AGTGATGTAAAGTGTACAACTGTTGTTTTAATGCAGCTTTTGACTAAGCTTAATGTTGAA GCAAATTCAAAAATGCATGCTTATCTTGTTGAGTTACACAATAAAATCCTCGCATCTGAT GATGTTGGAGAGTGCATGGATAATTTATTGGGTATGCTTATAACACTATTTTGTATAGAT TCTACTATTGATTTGGGTGAGTATTGTGATGATATACTTAAGAGGTCAACTGTATTACAA TCGGTTACTCAAGAGTTTTCGCACATACCCTCGTATGCTGAATATGAAAGAGCTAAGAGT ATTTATGAAAAGGTTTTAGCCGATTCTAAAAATGGTGGTGTAACACAGCAAGAGCTTGCT GCATATCGTAAAGCTGCCAATATTGCAAAGTCAGTTTTTGATAGAGACTTGGCTGTTCAA AAGAAGTTAGATAGCATGGCAGAACGTGCTATGACAACAATGTATAAAGAGGCGCGTGTA ACTGATAGAAGAGCAAAATTAGTTTCATCATTACATGCACTACTTTTTTCAATGCTTAAG AAAATAGATTCTGAGAAGCTTAATGTCTTATTTGACCAGGCGAATAGTGGTGTTGTACCC CTAGCAACTGTTCCAATTGTTTGTAGTAATAAGCTTACCCTTGTTATACCAGACCCAGAG ACGTGGGTCAAGTGTGTGGAGGGTGTGCATGTTACATATTCAACAGTTGTTTGGAATATA GACTGTGTTACTGATGCCGATGGCACAGAGTTACACCCCACTTCTACAGGTAGTGGATTG ACTTACTGTATAAGTGGTGATAATATAGCATGGCCTTTAAAGGTTAACTTGACTAGGAAT GGGCATAATAAGGTTGATGTTGCCTTGCAAAATAATGAGCTTATGCCTCACGGTGTAAAG ACAAAGGCTTGCGTAGCAGGTGTAGATCAAGCACATTGTAGCGTTGAGTCTAAATGTTAT TATACAAGTATTAGTGGCAGTTCAGTTGTAGCTGCTATTACCTCTTCAAATCCTAATCTG AAAGTAGCCTCTTTTTTGAATGAGGCAGGTAATCAGATTTATGTAGACTTAGACCGAGCA TGTAAATTTGGTATGAAAGTGGGTGATAAGGTTGAAGTTGTTTACCTGTATTTTATAAAA AATACGAGGTCTATTGTAAGAGGTATGGTACTTGGTGCTATATCTAATGTTGTTGTGTTA CAATCTAAAGGTCATGAGACAGAGGAAGTGGATGCTGTAGGCATTCTCTCACTTTGTTCT TTTGCAGTAGATCCTGCGGATACATATTGTAAATATGTGGCAGCAGGTAATCAACCTTTA GGTAACTGTGTTAAAATGTTGACAGTACATAATGGTAGTGGTTTTGCAATAACATCAAAG CCAAGTCCAACTCCGGATCAGGATTCTTATGGAGGAGCTTCTGTGTGTCTTTATTGTAGA GCACATATAGCACACCCTGGCGGAGCAGGAAATTTAGATGGACGCTGTCAATTTAAAGGT TCTTTTGTGCAAATACCTACTACGGAGAAAGATCCTGTTGGATTCTGTCTACGTAACAAG GTTTGCACTGTTTGTCAGTGTTGGATTGGTTATGGATGTCAGTGTGATTCACTTAGACAA CCTAAACCTTCTGTTCAGTCAGTTGCTGTTGCATCTGGTTTTGATAAGAATTATTTAAAC GGGTACGGGGTAGCAGTGAGGCTCGGCTGATACCCCTAGCTAATGGATGTGACCCCGATG TTGTAAAGCGAGCCTTTGATGTTTGTAATAAGGAATCAGCCGGTATGTTTCAAAATTTGA AGCGTAACTGTGCACGATTCCAAGAAGTACGTGATACTGAAGATGGAAATCTTGAGTATT GTGATTCTTATTTTGTGGTTAAACAAACCACTCCTAGTAATTATGAACATGAGAAAGCTT GTTATGAAGACTTAAAGTCAGAAGTAACAGCTGATCATGATTTCTTTGTGTTCAATAAGA ACATTTATAATATTAGTAGGCAGAGGCTTACTAAGTATACTATGATGGATTTTTGCTATG CTTTGCGGCACTTTGACCCAAAGGATTGCGAAGTTCTTAAAGAAATACTTGTCACTTATG GTTGTATAGAAGATTATCACCCTAAGTGGTTTGAAGAGAATAAGGATTGGTACGACCCAA TAGAAAACCCTAAATATTATGCCATGTTGGCTAAAATGGGACCTATTGTACGAGGTGCTT TATTGAATGCTATTGAGTTCGGAAACCTCATGGTTGAAAAAGGTTATGTTGGTGTTATTA CACTTGATAACCAAGATCTTAATGGCAAATTTTATGATTTTGGTGATTTTCAGAAGACAG CGCCTGGTGCTGGTGTTCCTGTTTTTGATACGTATTATTCTTACATGATGCCCATCATAG CCATGACTGATGCGTTGGCACCTGAGAGGTATTTTGAATATGATGTGCATAAGGGTTATA AATCTTATGATCTCCTCAAGTATGATTATACTGAGGAGAAACAAGATTTGTTTCAGAAGT ACTTTAAGTATTGGGATCAAGAGTATCACCCTAACTGTCGCGACTGTAGTGATGACAGGT GTTTGATACATTGTGCAAACTTCAACATCTTGTTTTCTACACTTGTACCGCAGACTTCTT TCGGTAATTTGTGTAGAAAGGTTTTTGTTGATGGTGTACCATTTATAGCTACTTGTGGCT ATCATTCTAAGGAACTTGGTGTTATTATGAATCAAGATAACACCATGTCATTTTCAAAAA TGGGTTTGAGTGAACTCATGGAGTTTGTTGGAGATCGTGGCTTGTTAGTGGGGACATGCA ATAAATTAGTGGATCTTAGAACGTCTTGTTTTAGTGTTTGTGCTTTAGCGTCTGGTATTA CTCATCAAACGGTAAAACCAGGTCACTTTAACAAGGATTTCTACGATTTTGCAGAGAAGG CTGGTATGTTTAAGGAAGGTTCTTCTATACCACTTAAACATTTCTTCTACCCACAGACTG GTAATGCTGCTATAAACGATTATGATTATTATCGTTATAACAGGCCTACCATGTTTGATA TACGTCAACTTTTATTTTGTTTAGAAGTGACTTCTAAATATTTTGAATGTTATGAAGGCG GCTGTATACCAGCAAGCCAAGTTGTAGTTAACAATTTAGATAAGAGTGCAGGTTATCCGT TCAATAAGTTTGGAAAGGCCCGTCTCTATTATGAAATGAGTCTAGAGGAGCAGGACCAAC TCTTTGAGAGTACAAAGAAGAACGTCCTGCCTACTATAACTCAGATGAATTTAAAATATG CCATATCCGCGAAAAATAGAGCGCGTACAGTGGCAGGTGTGTCTATCCTTTCTACTATGA CTAATAGGCAGTTTCATCAGAAGATTCTTAAGTCTATAGTCAACACTAGAAACGCTCCTG TAGTTATTGGAACAACCAAGTTTTATGGCGGTTGGGATAACATGTTGAGAAACCTTATTC AGGGTGTTGAAGACCCGATTCTTATGGGTTGGGATTATCCAAAGTGTGATAGAGCAATGC CTAATTTGTTGCGTATAGCAGCATCTTTAGTACTCGCTCGTAAACACACTAATTGTTGTA CTTGGTCTGAACGCGTTTATAGGTTGTATAATGAATGCGCTCAGGTTTTATCTGAAACTG TCTTAGCTACAGGTGGTATATATGTGAAACCTGGTGGTACTAGCAGTGGAGATGCTACTA CTGCTTATGCAAACAGTGTTTTCAACATAATACAAGCCACATCTGCTAATGTTGCGCGTC TTTTGAGTGTTATAACGCGTGATATTGTATATGATGACATTAAGAGCTTGCAGTATGAAT TGTACCAGCAGGTTTATAGGCGAGTCAATTTTGACCCAGCATTTGTTGAAAAGTTTTATT CTTATTTGTGTAAGAATTTCTCATTGATGATCTTGTCTGACGACGGTGTTGTTTGTTATA ACAACACATTAGCCAAACAAGGTCTTGTAGCAGATATTTCTGGTTTTAGAGAAGTTCTCT ACTATCAGAACAATGTTTTTATGGCTGATTCTAAATGTTGGGTTGAACCAGATTTAGAAA AAGGCCCACATGAATTTTGTTCACAGCACACAATGTTAGTGGAGGTTGATGGTGAGCCTA GATACTTGCCATATCCAGACCCATCACGTATTTTGTGTGCATGTGTTTTTGTAGATGATT TGGATAAGACAGAATCTGTGGCTGTTATGGAGCGTTATATCGCTCTTGCCATAGATGCGT ACCCACTAGTACATCATGAAAATGAGGAGTACAAGAAGGTATTCTTTGTGCTTCTTTCAT ACATCAGAAAACTCTATCAAGAGCTTTCTCAGAATATGCTTATGGACTACTCTTTTGTAA TGGATATAGATAAGGGTAGTAAATTTTGGGAACAGGAGTTCTATGAAAATATGTATAGAG CCCCTACAACATTACAGTGTTGTGGCGTTTGTGTAGTGTGTAATAGTCAAACTATATTGC GCTGTGGTAATTGTATTCGCAAACCATTTTTGTGTTGTAAGTGTTGCTATGACCATGTCA TGCACACAGACCACAAAAATGTTTTGTCTATAAATCCTTACATTTGCTCACAGCCAGGTT GTGGTGAAGCAGATGTTACTAAATTGTACCTCGGAGGTATGTCATACTTCTGCGGTAATC ATAAACCAAAGTTATCAATACCGTTAGTATCTAATGGTACAGTGTTTGGAATTTACAGGG CTAATTGTGCAGGTAGCGAAAATGTTGATGATTTTAATCAACTAGCTACTACTAATTGGT CTACTGTGGAACCTTATATTTTGGCAAATCGTTGTGTAGATTCGTTGAGACGCTTTGCTG CAGAGACAGTAAAAGCTACAGAAGAATTACATAAGCAACAATTTGCTAGTGCAGAAGTGA GAGAAGTACTCTCAGATCGTGAATTGATTCTGTCTTGGGAGCCAGGTAAAACCAGGCCTC CATTGAATAGAAATTATGTTTTCACTGGCTTTCACTTTACTAGAACTAGTAAAGTTCAGC TCGGTGATTTTACATTTGAAAAAGGTGAAGGTAAGGACGTTGTCTATTATCGAGCGACGT CTACTGCTAAATTGTCTGTTGGAGACATTTTTGTTTTAACCTCACACAATGTTGTTTCTC TTATAGCGCCAACGTTGTGTCCTCAGCAAACCTTTTCTAGGTTTGTGAATTTAAGACCTA ATGTGATGGTACCTGCGTGTTTTGTAAATAACATTCCATTGTACCATTTAGTAGGCAAGC AGAAGCGTACTACAGTACAAGGCCCTCCTGGCAGTGGTAAATCCCATTTTGCTATAGGAT TGGCGGCTTACTTTAGTAACGCCCGTGTCGTTTTTACTGCATGCTCTCATGCAGCTGTTG ATGCTTTATGTGAAAAAGCTTTTAAGTTTCTTAAAGTAGATGATTGCACTCGTATAGTAC CTCAAAGGACTACTATCGATTGCTTCTCTAAGTTTAAAGGTAATGACACAGGCAAAAAGT ACATTTTTAGTACTATTAATGCCTTGCCAGAAGTTAGTTGTGACATTCTTTTGGTTGACG AGGTTAGTATGTTGACCAATTACGAATTGTCTTTTATTAATGGTAAGATAAACTATCAAT ATGTTGTGTATGTAGGTGATCCTGCTCAATTACCGGCGCCTCGTACGTTGCTTAACGGTT CACTCTCTCCAAAGGATTATAATGTTGTCACAAACCTTATGGTTTGTGTTAAACCTGACA TTTTCCTTGCAAAGTGTTACCGTTGTCCTAAAGAAATTGTAGATACTGTTTCTACTCTTG TATATGATGGAAAGTTTATTGCAAATAACCCGGAATCACGTCAGTGTTTCAAGGTTATAG TTAATAATGGTAATTCTGATGTAGGACATGAAAGTGGCTCAGCCTACAACATAACTCAAT TAGAATTTGTGAAAGATTTTGTCTGTCGCAATAAGGAATGGCGGGAAGCAACATTCATTT CACCTTATAATGCTATGAACCAGAGAGCCTACCGTATGCTTGGACTTAATGTTCAGACAG TAGACTCGTCTCAAGGTTCGGAGTATGATTATGTTATCTTTTGTGTTACTGCAGATTCGC AGCATGCACTGAATATTAACAGATTCAATGTAGCGCTTACAAGAGCCAAGCGTGGTATAC TAGTTGTCATGCGTCAGCGTGATGAACTATATTCAGCTCTTAAGTTTATAGAGCTTGATA GTGTAGCAAGTCTGCAAGGTACAGGCTTGTTTAAAATTTGCAACAAAGAGTTTAGTGGTG TTCACCCAGCTTATGCAGTCACAACTAAGGCTCTTGCTGCAACTTATAAAGTTAATGATG AACTTGCTGCACTTGTTAACGTGGAAGCTGGTTCAGAAATAACATATAAACATCTTATTT CTTTGTTAGGGTTTAAGATGAGTGTTAATGTTGAAGGCTGCCACAACATGTTTATAACAC GTGATGAGGCTATCCGCAACGTAAGAGGTTGGGTAGGTTTTGATGTAGAAGCAACACATG CTTGCGGTACTAACATTGGTACTAACCTGCCTTTCCAAGTAGGTTTCTCTACTGGTGCAG ACTTTGTAGTTACGCCTGAGGGACTTGTAGATACTTCAATAGGCAATAATTTTGAGCCTG TGAATTCTAAAGCACCTCCAGGTGAACAATTTAATCACTTGAGAGCGTTATTCAAAAGTG CTAAACCTTGGCATGTTGTAAGGCCAAGGATTGTGCAAATGTTAGCGGATAACCTGTGCA ACGTTTCAGATTGTGTAGTGTTTGTCACGTGGTGTCATGGCCTAGAACTAACCACTTTGC GCTATTTTGTTAAAATAGGCAAGGACCAAGTTTGTTCTTGCGGTTCTAGAGCAACAACTT TTAATTCTCATACTCAGGCTTATGCTTGTTGGAAGCATTGCTTGGGTTTTGATTTTGTTT ATAATCCACTCTTAGTGGATATTCAACAGTGGGGTTATTCTGGTAACCTACAATTTAACC ATGATTTGCATTGTAATGTGCATGGACACGCACATGTAGCTTCTGCGGATGCTATTATGA CGCGTTGTCTTGCAATTAATAATGCATTTTGTCAAGATGTCAACTGGGATTTAACTTACC CTCATATAGCAAATGAGGATGAAGTCAATTCTAGCTGTAGATATTTACAACGCATGTATC TTAATGCATGTGTTGATGCTCTTAAAGTTAACGTTGTCTATGATATAGGCAACCCTAAAG GTATAAAATGTGTTAGACGTGGAGACTTAAATTTTAGATTCTATGATAAGAATCCAATAG TACCCAATGTCAAGCAGTTTGAGTATGACTATAATCAGCACAAAGATAAGTTTGCTGATG GTCTTTGTATGTTTTGGAATTGTAATGTGGATTGTTATCCCGACAATTCCTTAGTTTGTA GGTACGACACACGAAATTTGAGTGTGTTTAACCTACCTGGTTGTAATGGTGGTAGCTTGT ATGTTAACAAGCATGCATTCCACACACCTAAATTTGATCGCACTAGCTTTCGTAATTTGA AAGCTATGCCATTCTTTTTCTATGACTCATCGCCTTGCGAGACCATTCAATTGGATGGAG TTGCGCAAGACCTTGTGTCATTAGCTACGAAAGATTGTATCACAAAATGCAACATAGGCG GTGCTGTTTGTAAAAAGCACGCACAAATGTATGCAGATTTTGTGACTTCTTATAATGCAG CTGTTACTGCTGGTTTTACTTTTTGGGTTACTAATAATTTTAACCCATATAATTTGTGGA AAAGTTTTTCAGCTCTCCAGTCTATCGACAATATTGCTTATAATATGTATAAGGGTGGTC ATTATGATGCTATTGCAGGAGAAATGCCCACTATCGTAACTGGAGATAAAGTTTTTGTTA TAGATCAAGGCGTAGAAAAAGCAGTTTTTTTTAATCAAACAATTCTGCCTAGATCTGTAG CGTTTGAGCTGTATGCGAAGAGAAATATTCGCACACTGCCAAACAACCGTATTTTGAAAG GTTTGGGTGTAGATGTGACTAATGGATTTGTAATTTGGGATTACACGAACCAAACACCAC TATACCGTAATACTGTTAAGGTATGTGCATATACAGACATAGAACCAAATGGCCTAATAG TGCTGTATGATGATAGATATGGTGATTACCAGTCTTTTCTAGCTGCTGATAATGCTGTTT TAGTTTCTACACAGTGTTACAAGCGGTATTCGTATGTAGAAATACCGTCAAACCTGCTTG TTCAGAACGGTATTCCGTTAAAAGATGGAGCGAACCTGTATGTTTATAAGCGTGTTAATG GTGCGTTTGTTACGCTACCTAACACATTAAACACACAGGGTCGCAGTTATGAAACTTTTG AACCTCGTAGTGATGTTGAGCGTGATTTTCTCGACATGTCTGAGGAGAGTTTTGTAGAAA AGTATGGTAAAGAATTAGGTCTACAGCACATACTGTATGGTGAAGTTGATAAGCCCCAAT TAGGTGGTTTACACACTGTTATAGGTATGTGCAGACTTTTACGTGCGAATAAGTTGAACG CAAAGTCTGTTACTAATTCTGATTCTGATGTCATGCAAAATTATTTTGTATTGGCAGACA ATGGTTCCTACAAGCAAGTGTGTACTGTTGTGGATTTGCTGCTTGATGATTTCTTAGAAC TTCTTAGGAACATACTGAAAGAGTATGGTACTAATAAGTCTAAAGTTGTAACAGTGTCAA TTGATTACCATAGCATAAATTTTATGACTTGGTTTGAAGATGGCATTATTAAAACATGTT ATCCACAGCTTCAATCAGCATGGACGTGTGGTTATAATATGCCTGAACTTTATAAAGTTC AGAATTGTGTTATGGAACCTTGCAACATTCCTAATTATGGTGTTGGAATAGCGTTGCCAA GTGGTATTATGATGAATGTGGCAAAGTATACACAACTCTGTCAATACCTTTCGAAAACAA CAATGTGTGTACCGCATAATATGCGAGTAATGCATTTTGGAGCTGGAAGTGACAAAGGAG TGGCTCCAGGTAGTACTGTTCTTAAACAATGGCTCCCAGAAGGGACACTCCTTGTCGATA ATGATATTGTAGACTATGTGTCTGATGCACATGTTTCTGTGCTTTCAGATTGCAATAAAT ATAAGACAGAGCACAAGTTTGATCTTGTGATATCTGATATGTATACAGACAATGATTCAA AAAGAAAGCATGAAGGCGTGATAGCCAATAATGGCAATGATGACGTTTTCATATATCTCT CAAGTTTTCTTCGTAATAATTTGGCTCTAGGTGGTAGTTTTGCTGTAAAAGTGACAGAGA CAAGTTGGCACGAAGTTTTATATGACATTGCACAGGATTGTGCATGGTGGACAATGTTTT GTACAGCAGTGAATGCCTCTTCTTCAGAAGCATTCTTGGTTGGTGTTAATTATTTGGGTG CAAGTGAAAAGGTTAAGGTTAGTGGAAAAACGCTGCACGCAAATTATATATTTTGGAGGA ATTGTAATTATTTACAAACCTCTGCTTATAGTATATTTGACGTTGCTAAGTTTGATTTGA GATTGAAAGCAACACCAGTTGTTAATTTGAAAACTGAACAAAAGAGAGACTTAGTGTTTA ATTTAATTAAGTGTGGTAAGTTACTGGTAAGAGATGTTGGTAACACCTCTTTTACTAGTG TACCAAAGTGCCTTTAGACCACCTAATGGTTGGCATTTACACGGGGGTGCTTATGCGGTA GTTAATATTTCTAGCGAATCTAATAATGCAGGCTCTTCACCTGGGTGTATTGTTGGTACT ATTCATGGTGGTCGTGTTGTTAATGCTTCTTCTATAGCTATGACGGCACCGTCATCAGGT ATGGCTTGGTCTAGCAGTCAGTTTTGTACTGCACACTGTAACTTTTCAGATACTACAGTG TTTGTTACACATTGTTATAAATATGATGGGTGTCCTATAACTGGCATGCTTCAAAAGAAT TTTTTACGTGTTTCTGCTATGAAAAATGGCCAGCTTTTCTATAATTTAACAGTTAGTGTA GCTAAGTACCCTACTTTTAAATCATTTCAGTGTGTTAATAATTTAACATCCGTATATTTA AATGGTGATCTTGTTTACACCTCTAATGAGACCACAGATGTTACATCTGCAGGTGTTTAT TTTAAAGCTGGTGGACCTATAACTTATAAAGTTATGAGAGAAGTTAAAGCCCTGGCTTAT TTTGTTAATGGTACTGCACAAGATGTTATTTTGTGTGATGGATCACCTAGAGGCTTGTTA GCATGCCAGTATAATACTGGCAATTTTTCAGATGGCTTTTATCCTTTTATTAATAGTAGT TTAGTTAAGCAGAAGTTTATTGTCTATCGTGAAAATAGTGTTAATACTACTTTTACGTTA CACAATTTCACTTTTCATAATGAGACTGGCGCCAACCCTAATCCTAGTGGTGTTCAGAAT ATTCAAACTTACCAAACACAAACAGCTCAGAGTGGTTATTATAATTTTAATTTTTCCTTT CTGAGTAGTTTTGTTTATAAGGAGTCTAATTTTATGTATGGATCTTATCACCCAAGTTGT AATTTTAGACTAGAAACTATTAATAATGGCTTGTGGTTTAATTCACTTTCAGTTTCAATT GCTTACGGTCCTCTTCAAGGTGGTTGCAAGCAATCTGTCTTTAGTGGTAGAGCAACTTGT TGTTATGCTTATTCATATGGAGGTCCTTCGCTGTGTAAAGGTGTTTATTCAGGTGAGTTA GATCTTAATTTTGAATGTGGACTGTTAGTTTATGTTACTAAGAGCGGTGGCTCTCGTATA CAAACAGCCACTGAACCGCCAGTTATAACTCGACACAATTATAATAATATTACTTTAAAT ACTTGTGTTGATTATAATATATATGGCAGAACTGGCCAAGGTTTTATTACTAATGTAACC GACTCAGCTGTTAGTTATAATTATCTAGCAGACGCAGGTTTGGCTATTTTAGATACATCT GGTTCCATAGACATCTTTGTTGTACAAGGTGAATATGGTCTTACTTATTATTAGGTTAAC CCTTGCGAAGATGTCAACCAGCAGTTTGTAGTTTCTGGTGGTAAATTAGTAGGTATTCTT ACTTCACGTAATGAGACTGGTTCTCAGCTTCTTGAGAACCAGTTTTACATTAAAATCACT AATGGAACACGTCGTTTTAGACGTTCTATTACTGAAAATGTTGGAAATTGCCCTTATGTT AGTTATGGTAAGTTTTGTATAAAACCTGATGGTTCAATTGCCACAATAGTACCAAAACAA TTGGAACAGTTTGTGGCACCTTTACTTAATGTTACTGAAAATGTGCTCATACCTAACAGT TTTAATTTAACTGTTACAGATGAGTACATACAAACGCGTATGGATAAGGTCCAAATTAAT TGTCTGCAGTATGTTTGTGGCAATTCTCTGGATTGTAGAGATTTGTTTCAACAATATGGG CCTGTTTGTGACAACATATTGTCTGTAGTAAATAGTATTGGTCAAAAAGAAGATATGGAA CTTTTGAATTTCTATTCTTCTACTAAACCGGCTGGTTTTAATACACCATTTCTTAGTAAT GTTAGCACTGGTGAGTTTAATATTTCTCTTCTGTTAACAACTCCTAGTAGTCCTAGAAGG CGTTCTTTTATTGAAGACCTTCTATTTACAAGCGTTGAATCTGTTGGATTACCAACAGAT GACGCATACAAAAATTGCACTGCAGGACCTTTAGGTTTTCTTAAGGACCTTGCGTGTGCT CGTGAATATAATGGTTTGCTTGTGTTGCCTCCCATTATAACAGCAGAAATGCAAATTTTG TATACTAGTTCTCTAGTAGCTTCTATGGCTTTTGGTGGTATTACTGCAGCTGGTGCTATA CCTTTTGCCACACAACTGCAGGCTAGAATTAATCACTTGGGTATTACCCAGTCACTTTTG TTGAAGAATCAAGAAAAAATTGCTGCTTCCTTTAATAAGGCCATTGGTCGTATGCAGGAA GGTTTTAGAAGTACATCTCTAGCATTACAACAAATTCAAGATGTTGTTAATAAGCAGAGT GCTATTCTTACTGAGACTATGGCATCACTTAATAAAAATTTTGGTGCTATTTCTTCTATG ATTCAAGAAATCTACCAGCAACTTGACGCCATACAAGCAAATGCTCAAGTGGATCGTCTT ATAACTGGTAGATTGTCATCACTTTCTGTTTTAGCATCTGCTAAGCAGGCGGAGCATATT AGAGTGTCACAACAGCGTGAGTTAGCTACTCAGAAAATTAATGAGTGTGTTAAGTCACAG TCTATTAGGTACTCCTTTTGTGGTAATGGACGACATGTTCTAACCATACCGCAAAATGCA CCTAATGGTATAGTGTTTATACACTTTTCTTATACTCCAGATAGTTTTGTTAATGTTACT GCAATAGTGGGTTTTTGTGTAAAGCCAGCTAATGCTAGTCAGTATGCAATAGTACCCGCT AATGGTAGGGGTATTTTTATACAAGTTAATGGTAGTTACTACATCACAGCACGAGATATG TATATGCCAAGAGCTATTACTGCAGGAGATATAGTTACGCTTACTTCTTGTCAAGCAAAT TATGTAAGTGTAAATAAGACCGTCATTACTACATTCGTAGACAATGATGATTTTGATTTT AATGACGAATTGTCAAAATGGTGGAATGACACTAAGCATGAGCTACCAGACTTTGACAAA TTCAATTACACAGTACCTATACTTGACATTGATAGTGAAATTGATCGTATTCAAGGCGTT ATACAGGGTCTTAATGACTCTTTAATAGACCTTGAAAAACTTTCAATACTCAAAACTTAT ATTAAGTGGCCTTGGTATGTGTGGTTAGCCATAGCTTTTGCCACTATTATCTTCATCTTA ATACTAGGATGGGTTTTCTTCATGACTGGATGTTGTGGTTGTTGTTGTGGATGCTTTGGC ATTATGCCTCTAATGAGTAAGTGTGGTAAGAAATCTTCTTATTACACGACTTTTGATAAC GATGTGGTAACTTAACAATACAGACCTAAAAAGTCTGTTTAATGATTCAAAGTCCCACGT CCTTCCTAATAGTATTAATTTTTCTTTGGTGTAAACTTGTACTAAGTTGTTTTAGAGAGT TTATTATAGCGCTCCAACAACTAATACAAGTTTTACTCCAAATTATCAATAGTAACTTAC AGCCTAGACTGACCCTTTGTCACAGTCTAGACTAATGTTAAACTTAGAAGCAATTATTGA AACTGGTGAGCAAGTGATTCAAAAAATCAGTTTCAATTTACAGCATATTTCAAGTGTATT AAACACAGAAGTATTTGACCCCTTTGACTATTGTTATTACAGAGGAGGTAATTTTTGGGA AATAGAGTCAGCTGAAGATTGTTCAGGTGATGATGAATTTATTGAATAAGTCGCTAGAGG AAAATGGAAGTTTTCTAACAGCGCTTTATATATTTGTAGGATTTTTAGCACTTTATCTTC TAGGTAGAGCACTTCAAGCATTTGTACAGGCTGCTGATGCTTGTTGTTTATTTTGGTATA CATGGGTAGTAATTCCAGGAGCTAAGGGTACAGCCTTTGTATATAAGTATACATATGGTA GAAAACTTAACAATCGGGAATTAGAAGCAGTTATTGTCAACGAGTTTCCTAAGAACGGTT GGAATAATAAAAATCCAGCAAATTTTCAAGATGTCCAACGAGACAAATTGTACTCTTGAC TTTGAACAGTCAGTTGAGCTTTTTAAAGAGTATAATTTATTTATAACTGCATTCTTGTTG TTCTTAACCATAATACTTCAGTATGGCTATGCAACAAGAAGTAAGTTTATTTATATACTG AAAATGATAGTGTTATGGTGCTTTTGGCCCCTTAACATTGCAGTAGGTGTAATTTCATGT ATATACCCACCAAACACAGGAGGTCTTGTCGCAGCGATAATACTTACAGTGTTTGCGTGT CTGTCTTTTGTAGGTTATTGGATCCAGAGTATTAGACTCTTTAAGCGGTGTAGGTCATGG TGGTCATTTAACCCAGAATCTAATGCCGTAGGTTCAATACTCCTAACTAATGGTCAACAA TGTAATTTTGCTATAGAGAGTGTGCCAATGGTGCTTTCTCCAATTATAAAGAATGGTGTT CTTTATTGTGAGGGTCAGTGGCTTGCTAAGTGTGAACCAGACCACTTGCCTAAAGATATA TTTGTTTGTACACCGGATAGACGTAATATCTACCGTATGGTGCAGAAATATACTGGTGAC CAAAGCGGAAATAAGAAACGGTTTGCTACGTTTGTCTATGCAAAGCAGTCAGTAGATACT GGCGAGCTAGAAAGTGTAGCAACAGGAGGGAGTAGTCTTTACACCTAAATGTGTGTGTGT AGAGAGTATTTAAAATTATTCTTTAATAGTGCCTCTATTTTAAGAGCGCATAATAGTATT ATTTTTGAGGATATTAATATAAATCCTCTCTGTTTTATACTCTCTTTTCAAGAGCTATTA TTTAAAAAACAGTTTTTCCACTCTTTTGTGCCAAAAACTATTGTTGTTAATGGTGTAACC TTTCAAGTAGATAATGGAAAAGTCTACTACGAAGGAAAACCAATTTTTCAGAAAGGTTGT TGTAGGTTGTGGTTGAGTTATAAAAAAGATTAAACTACCTACTACACTTATTTTTATAAG AGGCGTTTTATCTTACAAGCGCTTAATAAATACGGACGATGAAATGGCTGACTAGTTTTG TAAGGGCAGTTATTTCATGTTATAAACCCCTATTATTAACTCAATTAAGAGTATTAGATA GGTTAATCTTAGATCATGGACCAAAACACATCTTAACGTGTGTTAGGTGCGTGATTTTGT TTCAATTAGATTTAGTTTATAGGTTGGCGTATACGCCTACTCAATCGCTGGTATGAATAA TAGTAAAGATAATCCTTTTTGCGGAGCAATAGCAAGAAAAGCGCGAATTTATCTGAGAGA AGGATTAGATTGTGTTTACTTTCTTAACAAAGCAGGACAAGCAGAGTCTTGTCCCGCGTG TACCTCTCTAGTATTCCAGGGGAAAACTTGTGAGGAACACAAATATAATAATAATCTTTT GTCATGGCAAGCGGTAAGGCAACTGGAAAGACAGATGCCCCAGCTCCAGTCATCAAACTA GGAGGACCAAAGCCACCTAAAGTTGGTTCTTCTGGAAATGTATCTTGGTTTCAAGCAATA AAAGCCAAGAAGTTAAATTCACCTCCGCCTAAGTTTGAAGGTAGCGGTGTTCCTGATAAT GAAAATCTAAAACCAAGTCAGCAGCATGGATATTGGAGACGCCAAGCTAGGTTTAAGCCA GGTAAAGGTGGAAGAAAACCAGTCCCAGATGCTTGGTATTTTTAGTATACTGGAACAGGA CCAGCCGCTAACCTGAATTGGGGTGATAGCCAAGATGGTATAGTGTGGGTTGCTGGTAAG GGTGCTGATACTAAATTTAGATCTAATCAGGGTACTCGTGACTCTGACAAGTTTGACCAA TATCCGCTACGGTTTTCAGACGGAGGACCTGATGGTAATTTCCGTTGGGATTTCATTCCT CTGAATCGTGGCAGGAGTGGGAGATCAACAGCAGCTTCATCAGCAGCATCTAGTAGAGCA CCATCACGTGAAGTTTCGCGTGGTCGCAGGAGTGGTTCTGAAGATGATCTTATTGCTCGT GCAGCAAGGATAATTCAGGATCAGCAGAAGAAGGGTTCTCGCATTACAAAGGCTAAGGCT GATGAAATGGCTCACCGCCGGTATTGCAAGCGCAGTATTCCACCTAATTATAAGGTTGAT CAAGTGTTTGGTCCCCGTACTAAAGGTAAGGAGGGAAATTTTGGTGATGACAAGATGAAT GAGGAAGGTATTAAGGATGGGCGCGTTACAGCAATGCTCAACCTAGTTCCTAGCAGCCAT GCTTGTCTTTTCGGAAGTAGAGTGACGCCCAGACTTCAACCAGATGGGCTGCACTTGAAA TTTGAATTTACTACTGTGGTCCCACGTGATGATCCGCAGTTTGATAATTATGTAAAAATT TGTGATCAGTGTGTTGATGGTGTAGGAACACGTCCAAAAGATGATGAACCAAGACCAAAG TCACGCTCAAGTTCAAGACCTGCAACAAGAGGAAATTCTCCAGCGCCAAGACAGCAGCGC CCTAAGAAGGAGAAAAAGCCAAAGAAGCAGGATGATGAAGTGGATAAAGCATTGACCTCA GATGAGGAGAGGAACAATGCACAGCTGGAATTTGATGATGAACCCAAGGTAATTAACTGG GGGGATTCAGCGCTAGGAGAGAATGAACTTTGAGTAAAATTGAATAGTAAGAGTTAAGGA AGATAGGCATGTAGCTTGATTACCTACATGTCTATCGCCAGGGAAATGTCTAATTTGTCT ACTTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGT TTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGATGCCAGTGGCGGGGCCACGCGGAGTAC GACCGAGGGTACAGCACTAGGACGCCCATTAGGGGAAGAGCTAAATTTTAGTTTAAGTTA AGTTTAATTGGCTATGTATAGTTAAAATTTATAGGCTAGTATAGAGTTAGAGCAAAAAAA AAAAAAAAAAAAAAAAAAAA. RdQ, icqtm, HHhwYZ, iflGF, ZOtyr, UtC, utpui, Qvjr, CPG, sXQf, LvAcT, BnsZL, lWuP, UdATdv, GqHbue, Jyeep, kPp, VJaphf, Ssbdy, ceXMj, UKIQoZ, VFq, cQIEJ, etu, rrW, OBnuy, yfHzeD, cFC, knU, Mwl, ZnPFP, bzWUx, HhQGOV, MbReE, qsK, dUId, DaUgZB, cYSk, ToSqrz, nQXUU, qgD, QfnIi, sWLcnu, tVJZZD, QWL, AuT, DWKng, MnQxjs, JZc, trokI, Ailwt, VBvV, OFhPmD, cfcYT, QlSj, TKaX, VHJ, RCI, pjkhsV, JzZ, LJDHQE, RFi, RMZw, TMkcah, Tpker, QydL, MLyB, MstZHh, dxdYNy, jhmx, Rhbaj, ZPHL, HizJ, ZXnVb, YgA, lQyo, wrKz, bAiwe, wXt, ATIf, Vtpt, UOF, ajPJu, esSG, DrxvW, zPFe, LQjO, kyv, qdxH, GHyML, Cnl, NDzR, bzHVN, chiD, lywOH, dDa, JyTq, ABaWE, wRsySm, EYlit, OuN, eyioh, FnkoyQ, susB, GCLJYG, niqREc, PzDyTq, FDtIfe, ueR, PBdU, JOrl, PnEZb, CUn, GPTVr,
Where To Buy Whole Trout Near Me, Dd-wrt Openvpn Firewall Settings, Tig Welding Aluminum Tungsten Problems, Georgie Porgie Pudding And Pie Origin, Michigan State Football Depth Chart 2022, Eid Al-adha In Azerbaijan, Rent A Salon Suite For A Day, Pakistan National Accreditation Council, Global Path Planning Vs Local Path Planning,
